Partes

From Tecnonautas
Jump to: navigation, search
Dengue Nuestro Proyecto Modelado Laboratorio Partes Equipo Tecnonautas en las Noticias Sponsors

Switches y Triggers

En principio, los Toehold Switches no serían partes estandarizables, ya que tanto la secuencia Trigger (complementaria a la secuencia que sensa el sistema) como el reportero elegido influyen en la secuencia y estructura del Switch. Dado que no contábamos con ningún Toehold Switch como base para armar nuestra construcción, y a que para trabajar con el genoma entero del dengue necesitaríamos condiciones de bioseguridad con las que no contamos, decidimos mandar a sintetizar ambas construcciones. Por cuestiones presupuestarias, las secuencias fueron pedidas como gene blocks (fragmentos de ADN doble cadena) en lugar de pedirse dentro de un plásmido.

Por lo tanto, colocamos sitios de restricción a ambos lados de estas partes para poder subclonarlas en distintos plásmidos. Elegimos usar el prefijo y sufijo estandarizados de iGEM e incluir un sitio de corte para XhoI en el extremo 3', ya que muchos plásmidos contienen sitios de corte para XbaI y XhoI en su Sitio de Clonado Múltiple. A su vez, incluimos 3 nucleótidos extra en cada uno de los extremos de los gene blocks, para lograr cortarlos con eficiencia con EcoRI y XhoI si fuera necesario.

ER.png

A futuro, queremos modelar un Toehold Switch que nos permita probar facilmente distintos reporteros sin tener que atravesar el paso de modelado cada vez. Por ejemplo, que en lugar de ser modelado con los primeros 29nt del reportero, tenga un linker proteico más largo, cuya secuencia de ADN corresponda además a algún sitio de corte de una enzima de restricción.

Reporteros

GFP

Para una primera prueba, elegimos utilizar como reportero GFP, pese a que no pueda verse con el ojo desnudo. Esta proteína ha sido estudiada y caracterizada extensivamente, y por lo tanto nos permite estudiar la acción del switch basandonos en protocolos que ya han sido probados. Encargamos la secuencia del Toehold Switch entero, incluyendo el siguiente gen de GFP:

ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAAT TTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACT ACCTGTTCCGTGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCACATGAAA CAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTACGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACT ACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGA AGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAG AATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAA ATACTCCGATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCC CAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACCGCTGCTGGGATTACACATGGCATGGATGAACTATAC AAAAGGCCTGCAGCAAACGACGAAAACTACGCTGCATCAGTTTAATAA

AmilCP

AmilCP es una cromoproteína de color azul. Nos interesó este reportero porque, según está reportado, puede observarse su color en cultivos de células bacterianas antes de las 24hs.

Utilizamos la parte iGEM [BBa_K592009], que nos cedió gentilmente el equipo de UADE, de la distribución 2015 de iGEM.

Esta parte viene en el siguiente plásmido:

Plasmidok592009.png

Plásmidos

Queremos expresar tanto el Switch como el Trigger bajo promotores inducibles compatibles, para caracterizar correctamente nuestro Switch. Para ello, pensamos en utilizar un promotor del operón lac y un promotor TetON, por ejemplo.

Contamos con una variedad de plásmidos pET, que tienen justamente el pLac, de los cuales elegimos el pET15b para clonar nuestra molécula Trigger.

Aún no hemos conseguido un vector con un promotor inducible por tetraciclina, donde clonar nuestro Switch.