Trabajo en el WetLab

From FCEN-UBA
Jump to: navigation, search
Logo.png

Guía de clonado para la construcción del biosensor de Melatonina

Los contenidos de esta guía fueron tomados, y modificados en los casos que fuese pertinente, de una guía que escribió originalmente nuestro coordinador Andreas Constantinou, al comenzar los experimentos en el laboratorio. A continuación se indican los procedimientos experimentales realizados y los protocolos empleados para conseguir la cepa de levaduras recombinante para nuestro biosensor.

Materiales

Medios de cultivo líquidos y placas

- Medio LB (Lysogeny Broth) Medio rico para crecer E. coli en cultivos líquidos. Se agregaron antibióticos para crecimiento selectivo. En el caso del antibiótico ampicilina, utilizamos una concentración de 100 µg/ml.

Medio YPD (Yeast Peptone Dextrose)

Medio rico para crecer levaduras en cultivos líquidos cuando ningún tipo de selección auxotrófica es requerida. Se agregaron antibióticos para crecimiento selectivo. En el caso del antibiótico geneticina (G418), utilizamos una concentración de 200 µg/ml.

Medio S (Sintético)

Medio mínimo para crecer levaduras en cultivo líquido. Es utilizado cuando se requiere un medio más controlado, en cuanto a su composición química, para crecer levaduras. En nuestro caso lo utilizamos para hacer un medio de selección de auxotrofías, donde nutrientes específicos son adicionados o no dependiendo la auxotrofía de la cepa de levadura en cuestión. Preparamos medio -HTU (medio que no contiene los aminoácidos histidina, triptofano y el ácido nucleico uracilo), ya que los plásmidos que utilizamos para transformar nuestras cepas de levaduras contienen dichos marcadores auxotróficos.

Medio GSM (Glutamato monosódico)

Similar al medio S pero con otra fuente de nitrógeno. Se emplea cuando la selección por medio de un antibiótico (en nuestro caso G418) debe ser combinada con una selección por auxotrofía, debido a que las levaduras tienden a no crecer adecuadamente en medio S con geneticina.

Placas de medios LB, YPD, S y GSM con agar.

Se les adiciona agar a los medios para obtener medios de cultivo semi-sólidos. También se les adicionan antibióticos, por ejemplo, para convertirlos en medios selectivos. El cultivo en placas nos permitió seleccionar colonias aisladas, lo cual es relevante cuando se realiza una transformación con un plásmido o fragmento de DNA que contiene un marcador de resistencia a antibióticos o un marcador auxotrófico específico.


Los reactivos utilizados para preparar los medios de cultivos fueron de la marca Sigma Aldrich®.

Cepas de levadura

Utilizamos levaduras con background genético llamado W303, el cual es una cepa de levaduras Saccharomyces cerevisiae con el siguiente genotipo:

W303 MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15} [phi+]link

Esto refiere a la cepa diploide. W303 es homocigota para todos los loci excepto el locus MAT.

ID Cepa MAT Cepa parental Bg Genotipo
Y1 YACL-379 a YAS245-SC W303 bar1Δ::little piece of URA3 but cells are ura-
Y2 TCY-387 a YACL-379 W303 prm1::PRM1-YFP::his5+, bar1Δ
Y3 TCY-3006 a TCY-387 W303 sst2Δ::TRP1,prm1::PRM1-YFP::his5+, bar1Δ
Y4 TCY-3002 a TCY-387 W303 ste2Δ::TRP1,prm1::PRM1-YFP::his5+, bar1Δ

Para nuestro biosensor debemos utilizar una cepa haploide ya que acoplaremos la respuesta del receptor MT2 al camino de señalización de feromonas sexuales en levaduras, así obteniendo un output cuantificable.

Las levaduras empleadas son derivadas de la cepa W303 y son todas haploides y por lo tanto hemicigotas para el locus MAT.

Hasta el momento nuestros experimentos han sido realizados con la cepa Y2. Las cepas Y1, Y3 y Y4 nos podrían ser de utilidad en el futuro.

¿Por qué elegimos estas cepas?

La cepa YACL-379 tiene el gen Bar1 delecionado. Esto no es estrictamente relevante para nuestro caso ya que Bar 1 cliva e inactiva el factor α, permitiendo a las células recuperarse del arresto celular inducido por el mismo. link En nuestro biosensor, construído con la cepa recombinante deseada, la melatonina jugará el rol del factor α. Esta cepa fue elegida simplemente porque es una cepa tipo en el laboratorio en el cual trabajamos, y es la cepa parental de las demás detalladas más arriba.

En la cepa TCY-387 el gen PRM1 ha sido reemplazado por el mismo gen fusionado a una proteína flourescente amarilla, PRM1-YFP. Debido a que el promotor del gen PRM1 es inducido en respuesta a feromona (factor α para las levaduras MAT a, por ej.), este gen podría ser utilizado como un reportero de la activación de este camino de señalización en las levaduras. Debido a que nuestro biosensor no cuantificará la concentración de melatonina a partir de la medición de la concentración de una proteína fluorescente en las células, este gen reportero no es de nuestro interés más inmediato. De todas formas, al utilizar esta cepa de levadura para construir nuestra cepa recombinante podríamos, al finalizar el trabajo, comparar la sensibilidad de dos métodos alternativos para medir melatonina: a través de un reportero fluorescente como YFP y por la realización de un ensayo de halo.

En la cepa TCY-3006 el gen Sst2 ha sido delecionado. La proteína Sst2 es el GAP de la proteína Gα, Gpa1, por lo que juega un rol importante en la desensibilizacion de la respuesta a feromona (el factor α) link. Por lo tanto si utilizamos la cepa TCY-3006 podríamos tener una respuesta aumentada frente a la estimulación con melatonina (o factor α), lo cual podría ser de interés en el caso de que necesitemos magnificar nuestro output. De todos modos, debido a que Sst2 previene el signalling desacoplado del receptor, usar una cepa como TCY-3006 para construir el biosensor representaría un compromiso entre la fidelidad y la amplitud de la señal mensurada.

En la cepa TCY-3002 el gen Ste2 ha sido delecionado. El gen Ste2 es aquel que codifica para la proteína del receptor. Medir la respuesta en una cepa como ésta nos permitirá cuantificar el “ruido” en nuestro output. Cabe destacar que cuando decimos “ruido” nos referimos a la activación/desactivación espontánea de la cascada de señalización río abajo del receptor. Y por supuesto, hay otros tipos de “ruidos” que se introducen en nuestro sistema al cambiar el receptor endógeno Ste2 por el MT2 y al generar una Gα quimera, que también deberían ser estudiados. Por ejemplo, si transformáramos esta cepa únicamente con el receptor MT2 y, en un segundo caso, la transformáramos tanto con el receptor MT2 como con la Gα quimera, podríamos tener una idea la eficacia del acoplamiento del receptor con la quimera generada, al comparar ambas respuestas obtenidas.

Plásmidos

Los plásmidos que utilizamos son los siguientes:

Nombre del plásmido Backbone Marcador Referencia
pFA6a-KANMX6 pFA6a Kanamycin(KANMX6) Longtine et al., 1998.
p414-TEF1p-Cas9-CYC1t pRS41z Tryptophan (TRP1) Di Carlo et al., 2013.
p426-SNR52p-gRNA.CAN1.Y-SUP4t pRS42z Uracil (URA3) Di Carlo et al., 2013.
pRS414 pRS41z TRP1 Sikorski R.S. et al., 1989.
pRS415 pRS41z LEU2 Sikorski R.S. et al., 1989.
pRS426 pRS42z URA3 Sikorski R.S. et al., 1989.

Todos estos plásmidos son todos shuttle vectors, es decir que se pueden propagar tanto en E. coli como en levaduras. Para la preparación de los mismos, los retransformamos en bacterias y he hicimos miniprep.

Cabe destacar que, por ejemplo, para transformar el plásmido p414-Cas9 en las cepas TCY-3002 y TCY-3006 deberíamos cambiar su marcador de selección por otro que no sea TRP1 ya que estas cepas ya poseen TRP1. Con lo cual este plásmido debería ser reclonado, utilizando como backbone algún otro plásmido de la serie pRS41z (Sikorski R.S. et al., 1989) con otro marcador de selección alternativo.

Primers

Aquí se detallan los primers utilizados para la construcción del biosensor.

Nombre Descripción Secuencia (5' a 3')
fwR1 Cambio del receptor con overhang TTAAAAATGCACCGTTAAGAACCATATCCAAGAATCAAAAATGTCAGAGAACGGCTCC
rvR1 Cambio del receptor con overhang CGAAGGTCACGAAATTACTTTTTCAAAGCCGTAAATTTTGCTAGAGAGCATCTGCCTG
fwR2 Cambio del receptor ATGTCAGAGAACGGCTCC
rvR2 Cambio del receptor CTAGAGAGCATCTGCCTG
fwR3 Control positivo 1 para receptor GCACTGCATTCAAGATGC
rvR3/5 Control pos/neg 1 para receptor ACCTTTAGACACGTGGGA 

fwR5 Control negativo 1 para receptor GGCACGCTGTCTAGCTTT
R1.mod Galpha transplant AACAGAATTTACGTATCTAAACACTACTTTAATTATACAGTTCCTGAATTCGAGCTCGTTTAAAC
F2.mod Galpha transplant GTATTGAGTGCAGTCACCGATCTAATCATCCAGCAAAACCTTAAAgactgcggcctcttctga CGGATCCCCGGGTTAATTAA
fwTEF Control positivo Galpha GATGCAGAAGCGGGTCTAAA
fwG4 Control negativo Galpha CAGCAAAACCTTAAAAAAATTGGTA
rvG3/4 Control negativo Galpha AGGGCATTCATTCAATTAATGAAAC
rvP1.Receptor PCR1 Insert TAGCTCTAAAACCAGTTCATCAGTAGAGGTGAgatcatttatctttcactgcgga
fwP2.Receptor PCR2 Insert ataaatgatcTCACCTCTACTGATGAACTGGTTTTAGAGCTAGAAATAGCAAGTTAAA
kanB pFA6a-pTEF binding for verification CTGCAGCGAGGAGCCGTAAT
kanC pFA6a-KanMX6 binding for verification TGATTTTGATGACGAGCGTAAT
T7 Flanks MCS in the pRS plasmid series. TAATACGACTCACTATAGGG
T3 Flanks MCS in the pRS plasmid series. AATTAACCCTCACTAAAGGG

Métodos

Clonado del receptor de melatonina

Para reemplazar el gen Ste2 de levaduras por el gen humano MTNR1B se seguirán los siguientes pasos:

(I) Transformar las cepas con el plásmido que expresa Cas 9. (protocolo trafo levs)

(II) Construir el plásmido con el gRNA (RNA guía) de forma tal que ésta guía tenga como target el locus Ste2 . (III) Amplificar el gen MTNR1B de cDNA humano

(IV) Transformar el plásmido del paso 2 y el DNA del receptor MTNR1B del paso 3 en las cepas del paso 1.

(VI) Verificar que las cepas se hayan modificado genéticamente en forma adecuada.

(V) Perder los plásmidos CRISPR/Cas 9 mencionados en los pasos 1 y 2.

(I) Preparación y transformación del plásmido Cas 9

El plásmido Cas 9 (p414-TEF1p-Cas9-CYC1t) lleva el marcador auxotrófico TRP1. Debido a que este marcador ya fue utilizado en la cepa TCY-3006 para delecionar el gen Sst2, debemos reclonar el plásmido en otro backbone pRS41z, con un marcador adecuado. Tanto para la cepa YACL-379 como para la cepa TCY-387, este procedimiento no es necesario.

Para reclonar dicho plásmido utilizaremos el siguiente método: Yeast gap repair, reparación por medio del sistema de recombinación homóloga de la levadura.

(1) Localizar los sitios de unión de los primers T7/T3 en el plásmido Cas 9. Luego elegir dos sitios de corte único de enzimas de restricción que flanqueen el inserto TEF1p-Cas9-CYC1t, pero que estén por dentro de la región de los primers T7/T3. En este caso se utilizaran los sitios Sac I y Kpn I (o AccG5I).

(2) Amplificar la región flanqueada por los primers T7/T3 en el plásmido Cas 9 por PCR.

(3) Digerir el plásmido target pRS41z con las dos enzimas de restricción elegidas. También se puede utilizar una tercera enzima cuyo sitio de corte se localize entre los de Sac I y KpnI, por ejemplo EcoRI. Preferentemente el producto amplificado por PCR y el plásmido deben tener al menos un solapamiento de 30 bp.

(4) Verificar la amplificación por PCR y la digestión mediante electroforesis en gel de agarosa. Extraer y purificar las bandas relevantes si es necesario.

(5) Transformar el producto de PCR y el DNA digerido directamente dentro de la cepa de levadura de interés, plaquear en agar con medio selectivo apropiado.

Debido a que hay dos fragmentos de DNA, entre los sitios de unión de los primers T7/T3 y los sitios de corte de las enzimas de restricción, donde las secuencias se solapan, las levaduras repararán los fragmentos de DNA utilizando recombinación homóloga y ensamblarán nuevamente un plásmido. Únicamente las levaduras que hayan ensamblado correctamente el plásmido serán capaces de expresar el gen marcador.

También es posible utilizar el método convencional de clonado por ER para reclonar el plásmido Cas 9. Elegimos el yeast gap repair por ser un método más rápido y simple, teniendo en cuenta que el proceso de recombinación homóloga en levaduras tiene una especificidad y eficiencia muy buenas. La única desventaja de este método frente al clonado convencional con ER es que debemos amplificar una región del plásmido por PCR (paso 2), por lo cual podemos estar introduciendo mutaciones indeseadas en este proceso. Por esta razón sería recomendable usar enzimas de alta fidelidad para realizar la PCR, como la enzima Pfu.

Luego de que las levaduras han sido transformadas con el plásmido que expresa Cas 9 estarán listas para la transformación con el DNA de MTNR1B y el plásmido con el RNA guía.

(II) Construcción de un plásmido gRNA cuyo target sea Ste2.

El procedimiento aquí será muy parecido al descrito en la sección anterior ya que también se utilizará el método de yeast gap repair. Alternativamente, se podría utilizar el método de Gibson Assembly para reconstruir el plásmido de interés in vitro. Nuevamente elegimos yeast gap repair por las ventajas que ofrece el mismo, ya enunciadas en la sección anterior.

(1) Localizar los sitios de unión de los primers T7/T3 en el plásmido p426-SNR52p-gRNA.CAN1.Y-SUP4t. Luego elegir dos sitios de corte único de enzimas de restricción que flanqueen el inserto SNR52p-gRNA.CAN1.Y-SUP4t, pero que estén por dentro de la región de los primers T7/T3.

(2) Amplificar la región SNR52p-gRNA.STE2.Y-SUP4t del plásmido gRNA por PCR usando los pares de primers diseñados para la construcción del RNA guía. Se realizarán 2 PCRs: 1. Primers: T3 y rvP1.Receptor; 2. Primers: fwP2.Receptor y t7.

(3) Digerir el plásmido pRS426 con las dos enzimas de restricción elegidas. En este caso se eligieron NotI y KpnI (o Acc65I). También se digirió con una tercera enzima cuyo sitio de restricción estuviese entre NotI y KpnI, nuevamente EcoRI. En particular, el sitio para Not I no figura en el mapa de restricción del plásmido del gRNA pero, de todas formas, esto no es relevante en este caso ya que se utilizará yeast gap repair para el ensamblado de los fragmentos de DNA. Recordemos que únicamente queremos obtener el backbone del plásmido pRS426 en cuestión. Preferentemente los productos amplificados por PCR y el backbone del plásmido deben tener al menos un solapamiento de 30 bp.

(4) Verificar la amplificación por PCR y la digestión mediante electroforesis en gel de agarosa. Extraer y purificar las bandas relevantes si es necesario.

(5) Reservar lo obtenido para realizar una transformación conjunta con el DNA amplificado del receptor MTNR1B.

(III) Amplificación del gen MTNR1B

Si se dispone de cDNA de células humanas que expresen funcionalmente el receptor de interés:

(1) Amplificar el gen MTNR1B del cDNA usando los primers sin overhang (fwR2 y rvR2). Verificar el producto del PCR por electroforesis en gel de agarosa. Aquí es nuevamente relevante no introducir muchas mutaciones al amplificar la región de cDNA deseada. Por lo cual también se tendrá que utilizar una polimerasa de alta fidelidad como Pfu.

(2) Usando el fragmento obtenido en (1) como templado, amplificar nuevamente el gen usando primers con overhang (fwR1 y rvR1). Verificar el producto obtenido por electroforesis.

(3) Purificar el producto de PCR.

(4) Reservar para transformación con el plásmido gRNA.

En nuestro caso disponíamos de cDNA de cs. HEK293, que expresan el receptor MT2 en bajas cantidades en comparación con el otro receptor de melatonina humano MT1 (Chan, 1997). Debido a que no pudimos amplificar el fragmento de interés de este cDNA probamos con cDNAs de otras líneas celulares humanas conocidas tales como HeLa, de las cuales no conocíamos con certeza si expresaban el receptor MT2. Sin embargo, por la naturaleza del rol fisiológico de la melatonina en el cuerpo humano era de esperar que el receptor MT2 que se expresara en forma basal en múltiples tejidos (Para mas informacion ver Proyecto) Nuevamente no obtuvimos resultados satisfactorios. Asimismo probamos partir de RNA de cs. HEK293, realizando una RT-PCR y luego amplificando el fragmento deseado a partir del cDNA obtenido. Esto lo realizamos como control ya que no teníamos certeza de la integridad de la primera muestra de cDNA que nos habían facilitado. Una vez más no conseguimos amplificar el receptor. Frente a este panorama empezamos a buscar líneas celulares humanas que expresaran al receptor MT2 en altas cantidades. A partir de esta posterior investigación hallamos algunas líneas específicas de cerebro, retina, páncreas y grasa parda humanas que cumplen con el requisito enunciado anteriormente (Reppert, 1995; Tosini, 2012; Karamitri, 2013; Brydon, 2001). Más específicamente conseguimos que nos facilitaran la línea celular ARPE-19, de células de epitelio pigmentado de retina (Zmijewski, 2009). Aún no hemos podido probar si es posible obtener el receptor MT2 de estas células ARPE-19 pero sería el próximo paso que realizaríamos a futuro, si continuásemos con el proyecto.

(IV) Transformación del plásmido gRNA y el receptor MTNR1B en una cepa que expresa el plásmido Cas 9.

Transformar conjuntamente el DNA del receptor MTNR1B con el plásmido gRNA en las cepas de levadura preparadas en la sección (I). Plaquear a las células transformadas en placas con un medio selectivo. Recordar seleccionar ambos plásmidos: Cas9 (marcador TRP1) y gRNA (marcador URA3).

(V) Verificación de que las células transformadas hayan sido modificadas en forma adecuada.

Una vez que se obtienen colonias aisladas en la placa de Petri, es crucial chequear que el gen MT2 haya sido reemplazado por el gen Ste2. Para hacer esto se debe realizar una colony PCR: consiste en una PCR en la cual el templado es una pequeña alícuota de levaduras y los primers son aquellos primers control diseñados

(1) Tomar 3 a 4 colonias por cepa transformada y re-estriar en nuevas placas con medio selectivo. Dejar crecer O.N.

(2) Realizar colony PCR con las colonias re-estriadas. Recordar incluir también un control negativo, que en este caso sería la cepa parental que fue transformada (“template control”). Verificar que los productos tengan el tamaño correcto por electroforesis en gel.

(3) Hacer un criostock de un clon positivo, guardar en la heladera a -80°C.

(VI) Perder los plásmidos CRISPR/Cas9.

Una vez que se han identificado clones positivos es necesario limpiar a la célula de los plásmidos introducidos. Para conseguir esto se crecen a las células en medio rico sin selección lo cual provoca que espontáneamente se pierdan los plásmidos. Se plaquean las células primero en medio rico. Una vez que se han formado colonias se realiza un “replica plate” en medio selectivo. Las colonias que crecen en medio rico pero NO crecen en medio con selección son aquellas que han perdido los plásmidos.

Clonado de la Galpha quimera o “transplant”

Para modificar el gen endógeno de levaduras Ste4 por la Galpha quimera deseada se requierá realizar lo sigueinte:

(I) Amplificar un cassette de integración (marcador) con overhangs de DNA específicos (II) Transformar a las cepas de levadura con el cassette amplificado (III) Verificar que las cepas hayan sido modificadas en forma exitosa

(I) Amplificación del cassette de integración

(1) Amplificar el cassette KANMX6 del plásmido pFA6a-KANMX6 usando los primers R1.mod y F2.mod. Verificar el producto por electroforesis en gel de agarosa. (2) Extraer y purificar el producto de PCR.

(II) Transformación del cassette amplificado KANMX6 en las cepas de levadura.

Se utiliza el mismo protocolo de transformación de levaduras pero se debe tener en cuenta que la selección con Kan (o G418) requiere más tiempo de recuperación (3 a 4 hs) antes de plaquear en el medio selectivo.

(III) Verificación que las células transformadas hayan sido modificadas en forma exitosa

Una vez que aparecen colonias en el agar (2 a 3 días), se necesita verificar que las células hayan sido modificadas en forma exitosa. En forma similar a lo planteado para el receptor en la sección 1.(V).

Nuestro proyecto en el tiempo...

Agosto: Se constituyó el team TECNOx. Expusimos nuestras expectativas con respecto a la participación en la competencia y compartimos nuestras primeras ideas de Biología Sintética.

Septiembre a Noviembre: Mucho brainstorming, investigación, lectura de bibliografía, consulta a expertos de diferentes temas. Consideramos luego de todo este período de búsqueda y evaluación de diferentes alternativas embarcarnos en la creación de Chronosense. Durante esta etapa creamos un logo para nuestro proyecto, investigamos acerca de biosensores y de la relevancia de la melatonina en el cuerpo humano. Nos contactamos con el Dr. Cardinali para que nos diera su opinión acerca de nuestra propuesta.

Diciembre: Empezamos a estudiar más en detalle cómo íbamos a implementar la solución, en particular qué tipo de métodos de clonado íbamos a utilizar para generar nuestra cepa de levaduras recombinante. Diseño de primers y encargo de los mismos.

Enero: Comenzamos a trabajar en el laboratorio. Nos familiarizamos con las técnicas de biología molecular que utilizaríamos para realizar los experimentos de clonado mientras que esperábamos la recepción de los primers. Preparamos medios de cultivo y placas. Descongelamos las cepas de levadura que utilizaríamos para crear nuestro propio stock, así como reclonamos los plásmidos de interés e hicimos miniprep para obtener nuestras propias alícuotas de los mismos.

Febrero: Primeros días de febrero, tras una larga espera de más de un mes, llegaron nuestros primers. ¡Ahora sí comenzamos a trabajar de lleno en nuestro proyecto!

Marzo: Habiendo puesto a punto cuestiones experimentales, continuamos trabajando en el laboratorio. También realizamos correcciones al modelado matemático, le dimos los toques finales al diseño industrial del prototipo, y gestionamos el nexo para conseguir la cepa de células que necesitamos para realizar el paso 1.(III) del WetLab, y así finalizar el proyecto.


Nuestro trabajo más intenso en el laboratorio transcurrió desde la semana del 7/02 a la semana del 7/03. Durante este tiempo pudimos completar todos los pasos de la guía de clonado menos el paso 1.(III) Amplificar el gen MTNR1B de cDNA humano. Tuvimos sucesivas dificultades para completar esta tarea, tal como se detalla en dicha sección de la guía.

Más allá del trabajo en el WetLab, tuvimos reuniones periódicas con los otros miembros del team que desarrollaron la parte de diseño del dispositivo y modelaron el sistema de estudio. Fue realmente interesante construir un lenguaje en común para poder entendernos (“entre los biólogos y los no-biólogos”) y compartir ideas y puntos de vista. Ciertamente algo muy enriquecedor de esta experiencia.

Referencias

[1] Brydon, L. et al. Functional expression of MT2 (Mel1b) melatonin receptors in human PAZ6 adipocytes. Endocrinology, 42(10):4264-71, Oct 2001.

[2] Chan, C.W. et al. Studies of melatonin effects on epithelia using the human embryonic kidney-293 (HEK-293) cell line. Endocrinology, 138(11):4732-9, Nov 1997.

[3] Di Carlo, J.E., et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research, Vol. 41, No. 7, 4336–4343, 2013.

[4] Longtine, M.S., et al. Additional Modules for Versatile and Economical PCR-based Gene Deletion and Modification in Saccharomyces cerevisiae. Yeast 14, 953–961, 1998.

[5] Reppert, S.M., et al. Molecular characterization of a second melatonin receptor expressed in human retina and brain: the Mel1b melatonin receptor. Proc Natl Acad Sci U S A., 12;92(19):8734-8, Sep 1995.

[6] Sikorski, R.S. et al. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122(1):19-27, May 1989.

[7] Tosini, G., et al. Melatonin: An underappreciated player in retinal physiology and pathophysiology. Elsevier, Experimental Eye Research 103, 82-89, 2012.

[8] Zmijewski, M.A., et al. The melatonin-producing system is fully functional in retinal pigment epithelium (ARPE-19). Elsevier, Molecular and Cellular Endocrinology 307, 211–216, 2009.